Characteristics of patents in various technical fields

The so-called "interlacing lines are like mountains", the types of inventions and creations in different technical fields vary widely. In the patent industry, when classifying the technical fields of patent documents, the International Patent Classification (International Patent Classification, IPC) established by the 1971 Strasbourg Agreement is commonly used, which provides a language-independent The hierarchical system composed of symbols is used to classify patents and utility models according to the different technical fields to which they belong. It is currently an internationally used tool for classifying and searching patent documents (see the table below).

Table  Chinese invention and utility model patent applications in 2017 according to the classification statistics of IPC department

IPC	constitute
A~H, total	100%
Part A, Human Necessities	13.2%
Section B, Operations, Transportation	28.9%
Department C, Chemistry, Metallurgy	6.9%
Department D, Textile, Paper	1.5%
Part E, Fixed Buildings	7.1%
Department F, Mechanical Engineering	11.9%
Department G, Physics	15.8%
Department H, Electrical	14.7%

The IPC classification system is classified by Section, Class, Subclass, Main Group, and Group to form a complete International Patent Classification.

Generally speaking, to automatically classify technical fields according to the IPC classification code, it is first necessary to read the information in the IPC classification code. For PCT patent applications, the IPC classification number will appear on the title page as a bibliographic item, and the general format is as follows.

Taking B64C25/02 as an example, the marking rules for IPC classification numbers are as follows:

Section, B - Operations, Transportation;

Major category, B64—indicates aircraft, aviation, and spacecraft, and the category number of the major category is marked with two digits;

Subclass, B64C—indicates flight, and the class number of the subclass is marked with capital letters;

Large group, B64C25/00—indicates landing gear, and the category number of the large group is marked with 1~3 digits plus /00;

Subgroup, B64C25/02 - The marking is to change the 00 in the large group/00 to other numbers.

General format for IPC symbols on the title page of the figure

Knowing the IPC classification number, if you want to index to a specific department/class/subclass/group/group, you can search online through the website. Many websites provide online search services for IPC classification codes, such as SooPat (http://www.soopat.com/IPC/Index).

In addition to roughly locating the field of a certain application case through the IPC classification code, or quickly classifying the fields of batch patent applications, in order to allow the project coordinator or project manager of the translation company to accurately entrust specific translation tasks to translators with professional capabilities Or, it also needs to be judged according to the specific content of the patent application case, especially the title of the invention.

Generally speaking, different translation teams have different standards for domain division, but in terms of technical content, drafting style, length of text, translation skills, etc., they can be roughly divided into three categories according to their similarities and differences.

1. Medicine/chemical industry

Medicine/chemical industry involves pharmacy, microbiology, genetics, botany, chemistry, textile, material science, medical equipment, chemical equipment, testing equipment, etc.

Some examples of specific invention titles are given below (the following Chinese and English invention titles are retrieved from the patent database Patbase at https://www.patbase.com):

1) Microbiocidal pyrazole derivatives/microbiocidal pyrazole derivatives.

2) Use and administration of pimavanserin/Use and administration of pimavanserin.

3) Fiber selective promoters/fiber selective promoters.

4) Computational methods for synthetic gene design/computational methods for synthetic gene design.

5) Conduit connector for patient breathing device/conduit connector for patient breathing device.

6) Gadolinium-terbium oxide nanoparticles/gadolinium oxide terbium nanoparticles.

7) Process and system for removing sulfur from sulfur-containing gaseous streams/ for removing sulfur from sulfur-containing gaseous streams and systems.

8) Device for biochemical processing and analysis of sample/devices for biochemical processing and analysis of samples.

9) Processes for starting up deep tank anaerobic fermentation reactors for making oxygenated organic compound from carbon monoxide and hydrogen

2. Mechanical/Engineering

Machinery/engineering involves daily necessities, vehicles, mechanical equipment, manufacturing processes, usage and working methods, etc.

Some examples of specific invention titles are given below:

1) Device for offline inspection and color measurement of printed sheets for the production of banknotes and like printed securities

2) Laptop elevation device/elevating device for portable computer.

3) Road sheltering and optimization/ road sheltering and optimization.

4) Umbrella, and tip element for umbrella frame/umbrella and tip element for umbrella frame.

5) Pole climbing fall prevention assembly/climbing pole fall prevention assembly.

6) Composite building module with thermal mass radiator/Composite building module with thermal mass radiator.

7) Brake control of vehicle based on driver behavior/vehicle brake control based on driver behavior.

3. Electronics/Communications

The electronics/communication category involves electrical and electronic related products and methods, optoelectronic technology, image processing, mobile communication and network technology, etc.

Some examples of specific invention titles are listed below:

1) Integrated semiconductor devices with amorphous silicon beam, methods of manufacture and design structure/ Integrated semiconductor devices with amorphous silicon beam, methods of manufacture and design structure.

2) Optimized semiconductor packaging in three-dimensional stack/ optimized semiconductor packaging in three-dimensional stack.

3) Named object view of electronic data report/named object view of electronic data report.

4) Communication between avatars in different games/ Communication between avatars in different games.

5) Spatially organized image collections on mobile devices/Spatially organized image collections on mobile devices.

6) Control area for touch screen/for the control area of ​​the touch screen.

7) Color channels and optical markers/color channels and optical markers.

Patent applications in different technology categories have different concerns. In order to make the classification easier, mechanical engineering and electronic communication are generally referred to as electromechanical. The following will introduce the characteristics of medical and chemical patents and mechanical and electrical patents in detail based on the above classifications.

1. Medical and chemical patents

Medical and chemical patents have high gold content and belong to the field of experimental science, which attaches great importance to examples and experimental data; product development time and cost are high, and the threshold for patents is high, so it is more dependent on patent protection. Often a patent is a network, which sets up a big obstacle for competitors. Patents in the medical and chemical fields generally have the following characteristics:

1) The files are relatively long, most of which are 10,000 to 100,000 words.

2) There are many drawings in the instruction manual, and there are many texts to be translated, most of which are experimental data sheets and diagrams of instrument test results.

3) Short sentences, simple grammar, and many technical terms.

4) There are many references.

5) There are many format requirements and there are special paragraphs.

6) There are many examples, many figures and tables in the text, and the internal repetition rate of the document is high.

In view of the above characteristics, the following aspects should be paid attention to during the translation process of medical and chemical patents.

(1) List of long term terms and their translation processing

(1) List of groups

【例1】eachR26 independently is halogen，cyano，amino，nitro，hydroxyl，mercapto，C1-C8 alkyl，C2-C8 alkenyl，C2-C8 alkynyl，C3-C8 cycloalkyl，C3-C8 cycloalkyl-C1-C4 alkyl，C3-C8 cycloalkyl-C1-C4 alkyloxy，C3-C8 cycloalkyl-C1-C4 alkylthio，C1-C8 alkoxy，C3-C8 cycloalkyloxy，C1-C8 alkenyloxy，C2-C8 alkynyloxy，C1-C8 alkylthio，C1-C8 alkylsulfonyl，C1-C8 alkylsulfinyl，C3-C8 cycloalkylthio，C3-C8 cycloalkylsulfonyl，C3-C8 cycloalkylsulfinyl，aryl，aryloxy，arylthio，arylsulfonyl，arylsulfinyl，aryl-C1-C4 alkyl，aryl-C1-C4 alkyloxy，aryl-C1-C4 alkylthio，heterocyclyl，heterocycyl-C1-C4 alkyl, heterocycyl-C1-C4 alkyloxy，heterocycyl-C1-C4 alkylthio, NH(C1-C8 alkyl)，N(C1-C8 al-kyl)2，C1-C4 alkylcarbonyl，C3-C8 cycloalkylcarbonyl，C2-C8 alkenylcarbonyl，C2-C8 alkynylcarbonyl，wherein alkyl，alkenyl，alkynyl，cycloalkyl，alkoxy，alkenyloxy，alkynyloxy and cycloalkoxy are optionally substituted by halogen, and wherein aryl and heterocyclyl are optionally substituted by one or more R27;......

(2) Similar sentence patterns

【例2】In one embodiment, a formulation useful herein comprises at least about 0.1,0.2，0.5，1,5，10，15，20，25，30，35，40，45，50，55，60，65，70，75，80，85，90，95，99，99.5，99.8 or 99.9% by weight of the composition comprising one or more gangliosides and useful ranges may be selected between any of these foregoing values(for example, from about 0.1 to about 50%，from about 0.2 to about 50%，from about 0.5 to about 50%，from about 1 to about 50%，from about 5 to about 50%，from about 10 to about 50%，from about 15 to about 50%，from about 20 to about 50%，from about 25 to about 50%，from about 30 to about 50%，from about 35 to about 50%，from about 40 to about 50%，from about 45 to about 50%，from about 0.1 to about 60%，from about 0.2 to about 60%，from about 0.5 to about 60%，from about 1 to about 60%，from about 5 to about 60%，from about 10 to about 60%，from about 15 to about 60%，from about 20 to about 60%，from about 25 to about 60%，from about 30 to about 60%，from about 35 to about 60%，from about 40 to about 60%，from about 45 to about 60%......)

(3) Similar expressions

【例3】In some embodiments of the method of paragraphs3-31，the glucanase and the xylanase have an amino acid sequence having at least 80% sequence identity with the respective SEQ ID，or any functional fragment thereof，being selected from the list consisting of SEQ ID NO:1 and SEQ ID NO:7;SEQ ID NO:2 and SEQ ID NO:7;SEQ ID NO:3 and SEQ ID NO:7;SEQ ID NO:4 and SEQ ID NO:7; SEQ ID NO:5 and SEQ ID NO:7;SEQ ID NO:6 and SEQ ID NO:7;SEQ ID NO:17 and SEQ ID NO:7;SEQ ID NO:18 and SEQ ID NO:7;SEQ ID NO:1 and SEQ ID NO:8;SEQ ID NO:2 and SEQ ID NO:8;SEQ ID NO:3 and SEQ ID NO:8;SEQ ID NO:4 and SEQ ID NO:8;SEQ ID NO:5 and SEQ ID NO:8;SEQ ID NO:6 and SEQ ID NO:8;SEQ ID NO:17 and SEQ ID NO:8;SEQ ID NO:18 and SEQ ID NO:8;SEQ ID NO:1 and SEQ ID NO:9;SEQ ID NO:2 and SEQ ID NO:9;SEQ ID NO:3 and SEQ ID NO:9;SEQ ID NO:4 and SEQ ID NO:9;SEQ ID NO:5 and SEQ ID NO:9;SEQ ID NO:6 and SEQ ID NO:9;SEQ ID NO:17 and SEQ ID NO:9;SEQ ID NO:18 and SEQ ID N0:9;SEQ ID NO:1 and SEQ ID N0:10;......

[Analysis] For similar terms or expressions listed in large paragraphs, no matter from the perspective of preventing omissions or saving typing time or word search time, it is worth adopting a method different from conventional single word and single sentence translation after analyzing the sentence pattern. Commonly used methods include:

1) For a large number of professional terms (such as insects, microorganisms, diseases, etc.), query professional websites, download professional terms in batches, and read them one by one after making a glossary or term base. Lay the foundation for quick handling in similar cases.

2) For large chemical groups or compounds, batch replacement and cyclic replacement can be used, which can not only avoid the risk of confusing similar words to the naked eye, but also avoid missing any item in the long list.

3) For the similar sentence patterns in Example 2 and Example 3, replacement is a very effective way, especially in Example 2, which contains punctuation in the replacement content, such as ", from about" can be replaced with ", from about", "to about " can be replaced by "% to about", and in Example 3, it is necessary to pay attention to the position of similar items in the entire sentence.

(2) A large number of professional terms and their translation processing

(1) List of insects

【例4】Insect pests mentioned in the invention for the major crops include：Pseudaletia unipunctata, army worm; Spodoptera frugiperda, fall armyworm; Elasmopalpus lignosellus，lesser cornstalk borer; Agrotis orthogonia, western cutworm; Elasmopalpus lignosellus，lesser cornstalk borer; Oulemame lanopus, cereal leaf beetle; Hypera punctata，clover leaf weevil; Diabrotica undecimpunctata howardi, southern corn rootworm; Russian wheat aphid; Schizaphis graminum, greenbug; Macrosiphum avenae，English grain aphid; Melanoplus femurrubrum，redlegged grasshopper; Melanoplus differentialis，differential grasshopper; Melanoplus sanguinipes, migratory grasshopper; Mayetiola destructor, Hessian fly; Sitodiplosis mosellana, wheat midge; Meromyza Americana, wheat stem maggot; Hylemya coarctata, wheat bulb fly; Frankliniella fusca，tobacco thrips; Cephus cinctus，wheat stem sawfly; Aceria tulipae，wheat curl mite; Sunflowe......

(2) New drug name

[Example 5] See the table below for the name of the drug.

Table  New drug name

Compound

Upadacitinib

ENMD-2076 ((E)-N-(5-Methyl-1H-pyrazol-3-yl)-6-(4-methylpiperazin-1-yl)-2-styrylpyrimidin-4-amine)

JTE-052(from company Japanese Tobacco International, LEO Pharma)

BMS-911543(N，N-dicyclopropyl-4-((1,5-dimethyl-1H-pyrazol-3-yl)amino)-6-ethyl-1-methyl-1,6-dihydroimidazo[4,5-d]pyrrolo[2,3-b]pyridine-7-carboxamide)

gandotinib

cerdulatinib

TG-02，also known as SB-1317 from Tragara Pharmaceuticals

peficitinib

itacitinib

ganetspib

lestaurtinib

【Analysis】

1) For a large number of professional terms (such as insects, microorganisms, diseases, etc.), query professional websites, download professional terms in batches, and read them one by one after making a glossary or term base. Lay the foundation for quick handling in similar cases.

2) There is often no official translation of drug names that are newly launched or in the experimental stage in China, and most of the citations in professional papers are directly quoted from the original English text, which adds a lot of difficulty to the translator in the process of translating drug names . Translators need to consult authoritative websites in related fields and study the composition of drug names of various drugs in order to give the closest possible translation. When necessary, according to Section 3.3, Chapter 1, Part V of the Guidelines for Patent Examination, "Patent application documents that are in a foreign language shall be translated into Chinese, and technical terms in foreign languages ​​shall be translated into Chinese in accordance with regulations, and standardized terms shall be used. If there is no unified Chinese translation method for foreign language scientific and technological terms, they can be translated into Chinese according to general practice, and the original text should be indicated in brackets after the translation, and the original text can be indicated in brackets after the translation.

(3) A large number of cited documents and product names and their translation processing

The proportion of theoretical analysis in medical and chemical patents is relatively large, and a large number of documents are often required to support the theory and method system, so a large number of references are often cited; at the same time, in order to describe the experimental raw materials and analytical instruments in detail, as a reproducible experimental result It is proved that there will be a large number of product names and company names, which is also a major feature of medical and chemical patents.

(1) Citations

【例6】See D.Dabelea et al.,“ The Coronary Artery Calcification in Type 1 Diabetes(CACTI)Study,” Diabetes 52:2833-9, 2003;J.Rumberger et al.,“ Electronbeam tomographic coronary calcium scanning: a review and guidelines for use in asymptomatic persons,” Mayo Clin Proc74:243-52, 1999; J.Olson et al.,“ Coronary calcium in adults with type 1 diabetes: a stronger correlate of clinical coronary artery disease in men than in women,”Diabetes49:1571-8,2000;Y Arad et al.,“ Prediction of coronary events with electron-beam tomography,” J Am Coll Cardiol36:1253-60, 2000;P.Raggi et al., “ Identification of patients at increased risk of unheralded myorcardial infarction by Electron-Beam Computed Tomography,” Circulation101:850-5，2000; J.Rumberger et al.,“ Coronary Calcium, as Determined by Electron Beam Computed Tomography, and Coronary Disease on Arteriogram,”Circulation91:1363-7, 1995;and R.Detrano et al.,“ Coronary calcium as a predictor of coronary events in four racial or ethnic groups,” New England Journal of Medicine358:1336-45,2008.

(2) Product name

【例7】One PEP known as pancrelipase is commercially available in the form of enteric coated particles incorporated into capsules which contain up to35,000USP units/capsule of pancrelipase(e.g., PANCRECARB®(Digestive Care, Inc.), ULTRASE®(Axcan Scandipharm Inc.), PANCREAZE™(McNeil Pharmaceutical), COTAZYME®(Organon USA, Inc.), ZENPEP®(Eurand Pharmaceuticals)and CREON®(Solvay Pharmaceuticals, Inc.)).

【Analysis】

1) For the translation of cited documents, names of persons and companies, the Guidelines for Patent Examination stipulates: "If there is no unified Chinese translation of foreign names, place names and scientific and technological terms, the original text shall be indicated", "the cited foreign patent documents, patent The source and title of the application and non-patent documents shall be in the original language, and if necessary, a Chinese translation shall be provided, and the translation shall be placed in brackets."

2) In order to avoid retaining too much of the original text in the translation, the general practice in the industry when translating English into Chinese is: foreign names, registered trademarks, and product names are not translated but the original text is retained; place names, company names are translated, and are not popular in the translation. Place the original text in brackets after the translation; keep the original text for the title of the cited document, and place the translation in brackets after the original text.

(4) A large number of figures and tables in the text and their translation processing

In medical and chemical patents, when describing substance transformation, analyzing substance properties, and summarizing experimental data, it is often necessary to use diagrams and tables in the text (different from the diagrams and tables in the accompanying drawings).

(1) Tables in the text

【Example 8】See the table below for the table in the text.

Table  Example table in the text

method code	column	mobile phase	gradient	Flow - Col T	Runtime - BPR
SFC-A	Daicel Chiralpak® IC column(5μm, 150*4.6mm)	A:C02 B：MeOH	30% B hold 7 min	3 - 35	7 - 100
SFC-B	Daicel Chiralpak® IC column(5μm, 150*4.6mm)	A:CO2 B: iPrOH+ 0.3% iPrNH2	40% B hold 7 min	3 - 35	7 - 100
SFC-N	Daicel Chiralpak® AD3 column(3μm, 150*4.6mm)	A:CO2 B: EtOH +0.2% iPrNH2 +3% H20	45% B hold 6 min, to 50% in 1 min, hold 2.5 min	2.5 - 40	9.5 - 110
SFC-O	Daicel Chiralpak® AD3 column(3μm, 150*4.6mm)	A: CO2 B: EtOH +0.2% iPrNH2 +3% H20	35% B hold 6 min, to 50% in 1 min, hold 2.5 min	2.5 - 40	9.5 - 110

(2) chemical formula

【例9】R1is-NHC(=0)R6, -NHC(=O)(CH2)nR6, -NH(CH2)nC(=O)R6, -NHC(=O)(CH2)mHR5, -NHC) =O)(CH2)mN(R5)2, -NHC(=O)(CHR9)mNHR5, -NHC(=O)(CH2) mNH2, -NHC(=O)(CH2)nOR9, -NHC(=O (0R9,-NH(CH2)mC(=O)N(R5)2,-NH(CHR9)nC(=O)R6, -NHC(=O)(CHR9)nR6, -NHC(=O)(CHR9 )nN(R8)2, -NHC(=O)(CHR9)nNHR8, -NH(CHR9)nC(=O)N(R8)2, -NH(CHR9)mC(=O)R6, -NHR6, - NR5R6, -NH2, -N(R5)2, -NHR5, -NHR8, -N(R6R8), -NH(C(R9)2)nR10, -NR9C(=O)0R11, -NHCH2(CHR9)nOR9, -NH(CHR9)nOR9, -NR9(CH2)nOR9, -NHCH2(C(R9)2)nOR9, -OR9,-NR9C(=O)R5,-NR9C(=O)(CH2)nR5, -NR9c) =O)OR5,-NHS(=O)2R5, -NHC(=O)(CH2)nNR9C(=O)R5, -NHC(=O)(CH2)nNR9S(=O)R5, ..... .

(3) Chemical reaction process

[Example 10] The chemical reaction process is shown in the figure below.

Figure chemical reaction process example

【Analysis】

1) The text content in the figures and tables in the article needs to be translated. The table in the text of Example 8 can be edited directly, but there is often a mixture of elements to be translated and non-translated elements, which need to be carefully distinguished.

2) For examples 9 and 10, they appear in the form of marks in computer-aided translation tools, which are often overlooked by translators. Therefore, before translation, you should first browse the special formats contained in the original file, so that you can separate them before or after translating the main text deal with.

3) The picture of the chemical reaction in Example 10 contains text describing the reactants and conditions, which need to be converted into the corresponding translation and re-placed on the picture in the form of a drawing.

(5) Complex formats and their translation processing

(1) Nucleotide and amino acid sequences

[Example 11] SEQ ID NO:61:

NNNNNNNNNNNNNNNNNNNNguuuuuguacucucaagauuuaGAAAuaaaucuugcagaagcuacaaagauaaggcuucaugccgaaaucaacacccugucauuuuauggcaggguguuuucguuauuuaa, 

SEQ ID NO: 62:

NNNNNNNNNNNNNNNNNNNNguuuuuguacucucaGAAAugcagaagcuacaaagauaa

ggcuucaugccgaaaucaacacccugucauuuuuauggcaggguguuuucguuauuuaa, 

SEQ ID NO: 63:

NNNNNNNNNNNNNNNNNNNNguuuuuguacucucaGAAAugcagaagcuacaaagauaa

ggcuucaugccgaaaucaacacccugucauuuuuauggcagggugu,

 …

(2) NMR spectrum data

【例12】Partial 1H NMR(D20,300MHz)：88.68(s, 1H, FA H-7), 7.57(d, 2H, J=8.4Hz, FA H-12&16), 6.67(d, 2H, J=9Hz, FA H-13&15), 4.40-4.75(series of m, 5H), 4.35(m, 2H), 4.16(m, 1H), 3.02(m, 2H), 2.55-2.95(series of m, 8H), 2.42(m, 2H), 2.00-2.30(m, 2H), 1.55-1.90(m, 2H), 1.48(m, 2H)ppm.

【Analysis】

1) For such passages dominated by non-translated elements, copying the original text into the translation is a better way to ensure the correctness of the translation. It is obviously not realistic to check the consistency between the translation and the original text with the naked eye.

2) In such paragraphs, such as the NMR data in Example 12, individual words that need to be translated are often hidden, such as "partial" and "series of", which are easily overlooked by the translator and require vigilance.

(6) Complex logical relationships in long sentences and their translation processing

Since many parallel nouns or expressions of the same kind are often used in medical and chemical patents, when this series of nouns or expressions appear as a component in a sentence, it will bring difficulties for the translator to understand the completeness of the sentence.

【例13】Y1 represents hydrogen, halogen, CN, N02, C1-C6 alkyl, C3-C8 cycloalkyl, C3-C8 cycloalkenyl, C2-C6 alkenyl, C2-C6 alkynyl, phenyl, naphthyl, a5-to10-membered mono-or bicyclic heterocycle containing one to three heteroatoms independently selected from O, S and N, providing that the heterocycle does not contain adjacent oxygen atoms, adjacent sulphur atoms, or adjacent sulphur and oxygen atoms, wherein the heterocycle can be aromatic, or fully or partially saturated, OR1, CO2R1, COR2, CON(R3)2, N(R3)2, NR3COR2 and C(R2)=N-OR1, wherein the alkyl, cycloalkyl, cycloalkenyl, alkenyl, alkynyl, phenyl, naphthyl, and heterocycle are optionally substituted by one or more groups in dependently selected from halogen, CN, OH, NH2, NR3COR2, SH, N02, OR1, C1-C4 alkyl, C1-C4 haloalkyl, phenyl, halophenyl, C1-C4 alkylphenyl, C3-C8 cycloalkyl, C3-C8 cycloalkenyl, C1-C4 alkylthio, C1-C4 alkylsulphinyl and C1-C4 alkylsulphonyl;

【Reference translation】Y1 represents hydrogen; halogen; CN; NO2; C1~C6 alkyl; C3~C8 cycloalkyl; c3~c8 cycloalkenyl; c2~c6 alkenyl; group; a 5- to 10-membered mono- or bicyclic heterocycle containing one to three heteroatoms independently selected from O, S and N, with the proviso that the heterocycle does not contain adjacent oxygen atoms, adjacent Sulfur atom, or adjacent sulfur and oxygen atoms, where the heterocycle may be aromatic, or fully or partially saturated; OR1; CO2R1; COR2; CON(R3)2; N(R3)2; NR3COR2 and C (R2)=N-OR1; wherein the alkyl, cycloalkyl, cycloalkenyl, alkenyl, alkynyl, phenyl, naphthyl, and heterocycle are optionally independently selected from one or more of the following Multiple group substitution: halogen, CN, OH, NH2, NR3 COR2, SH, N02, OR1, C1~C4 alkyl, C1~C4 haloalkyl, phenyl, halophenyl, C1~C4 alkylphenyl , C3~C8 cycloalkyl, C3~C8 cycloalkenyl, C1~C4 alkylthio, C1~C4 alkylsulfinyl and C1~c4 alkylsulfonyl;

【例14】The compounds of formula II, wherein R5, R6, R7, R8, R9, R10, R11, T, Y1, Y2, Y3, Y4, n, p, Q are as defined for formula I and A is hydrogen, a protecting group such as acetyl, benzyl or tert-butoxycarbonyl or a group M, can be obtained by transformation of a compound of formula III, wherein R5, R6, R7, R8, R9, R10, R11, T, Y1, Y2, Y3, Y4, n, p are as defined for formula I and A is hydrogen, a protecting group such as acetyl, benzyl or tert-butoxycarbonyl or a group M, with a compound of formula IV, wherein R12andQ are as defined for formula I and X is a hydroxy, halogen, preferably fluoro, chloro or bromo or alkoxy, such as methoxy, ethoxy.

【Reference translation】The compound of formula II, wherein R5, R6, R7, R8, R9, R10, R11, T, Y1, Y2, Y3, Y4, n, p, Q are as defined in formula I, and A is hydrogen, For example, protecting groups such as acetyl, benzyl or tert-butoxycarbonyl, or group M, can pass through the compound of formula III, wherein R5, R6, R7, R8, R9, R10, R11, T, Y1, Y2, Y3, Y4, n, p are as defined in formula I, and A is hydrogen, such as protecting groups such as acetyl, benzyl or tert-butoxycarbonyl, or group M, obtained by conversion with a compound of formula IV, wherein R12 and Q are as defined in formula I, and X is hydroxy, halogen, preferably fluorine, chlorine or bromine, or alkoxy, such as methoxy, ethoxy.

【Analysis】

1) In Example 13, the entire sentence is separated by commas, but it is obvious that some commas are in parallel, some commas are the relationship between the modified object and the modifier, and some commas belong to different sentences. At this time, when translating into Chinese, it is necessary to combine punctuation marks such as "," "," ";" to disconnect the enumerated content to help improve the readability of the Chinese text. If you just copy "," into Chinese as it is, the clarity of Chinese writing logic will be greatly damaged.

2) In Example 14, there are many parentheses introduced by "wherein". When translating such sentences, the position of this sentence in the patent application specification should be determined first, so as to judge whether it is a noun phrase or a complete subject-predicate-object structure sentence. This sentence has an obvious predicate "can be", so it is first necessary to extract the main sentence "The compounds of formula II...can be obtained by transformation of a compound of formula III...with a compound of formula IV".

3) As for the logical relationship in each "wherein" clause, it can be judged by "and" and "or". In patents, especially in the claims of medical and chemical patents, the features of the invention are often connected by "and" and "or". In the translation process, behind this seemingly simple "and" and "or" relationship There are often huge "hidden dangers" hidden, and it is also the key to accurately splitting sentences and sorting out logical relationships. In Example 14, the "and" in "and A is" splits the conditional sentence in "wherein" into two sentences, and the "or" in "benzyl or tert-butoxycarbonyl" in the second sentence represents the enumeration of "a protecting group" The item ends, and the "or" in the last "or a group M" means that the enumerated items of "A" end.

(7) Special documents and their translation

Because medical and chemical patents may involve genetic material or new plant varieties, other attachment materials need to be submitted along with the patent application documents, and such materials also need to be translated.

(1) If nucleotide or amino acid sequence is involved, the sequence list shall be provided

Paragraph 5 of Article 17 of the "Detailed Rules for the Implementation of the Patent Law" stipulates: "Where the application for a patent for invention contains one or more nucleotide or amino acid sequences, the description shall include a sequence listing that complies with the regulations of the patent administrative department of the State Council. The applicant shall submit the The sequence listing is submitted as a separate part of the description, and a computer-readable copy of the sequence listing is submitted in accordance with the regulations of the patent administration department of the State Council."

(2) If some new biological materials are involved, a biological deposit certificate is required

Article 24 of the Detailed Rules for the Implementation of the Patent Law stipulates: “The invention for which a patent is applied for involves a new biological material that is not available to the public, and the description of the biological material is not sufficient to enable those skilled in the art to practice the invention. , in addition to complying with the relevant provisions of the Patent Law and these Rules, the applicant should also go through the following procedures: (1) Before the date of filing or at the latest on the date of filing (if there is priority, the priority date), the biological material The sample should be submitted to the depository institution recognized by the patent administration department of the State Council for preservation, and the deposit certificate and survival certificate issued by the depository institution should be submitted at the time of application or within 4 months from the date of application at the latest."

The sequence listing is a type of document that is different from patents in other fields. The contents appearing in the sequence listing can be roughly divided into three categories: company name and inventor information, terminology, and stylized title. The company name and other information need to be translated according to the translation method provided by the customer or search for the official company name by yourself; the terminology needs to be consistent with the translation method in the manual; the stylized title should be processed according to the fixed translation method.

2. Mechanical and electrical patents

The survival of mechanical and electrical enterprises depends on the continuous updating of technology. Their patent applications are dominated by the number of surprises. They often lay out multiple or even dozens of patents along the new research and development direction to protect the core technology and form a patent pool in order to monopolize the market. Purpose. The writing of its patent documents tends to be established by mathematical logic, and often less experimental research can derive and support many patent applications.

1) The documents are relatively short, mostly 2,000 to 20,000 words.

2) There are many drawings in the manual, and it is difficult to understand technically in combination with the drawings.

3) The technical terms are common, but the translation method is flexible.

4) Sentences are grammatically complex.

5) There are many part-of-speech conversions.

In the translation process, compared with medical and chemical patents, translators of mechanical and electrical patents often have the feeling that the terms seem common and simple, but they have no way to start and are complicated to understand. Different from a large number of nouns such as compounds, drugs, microorganisms, and diseases in medical and chemical patents, mechanical and electrical patents describe more technologies that are closely related to today's life. The terms seem to be familiar, but due to the uniqueness of the technology, common terms are often used in Different meanings are given to different documents or in different contexts of the same document, and mechanical and electrical patents focus more on describing the working principle, structure and positional relationship, so they will rely more on the drawings, so translators are required to fully and accurately understand the technology based on the drawings After understanding the principles, make an accurate judgment on the relationship between technical terms and features, which is often impossible to achieve only through grammatical ability.

The following example illustrates.

(1) Complex logical relationships and their translation processing

[例16]Up to a predefined number n0 of wafers, an APC setting may calculate the exposure dose for the next single wafer on the basis of one or more previously measured critical dimensionsCD(n)，CD(n-1)in APC step570.

Figure flow chart (excerpt)

【原句】In APC step 570, up to a predefined number n0 of wafers, the APC settings can be calculated for the next single The exposure dose of the wafer.

[Analysis] "APC step 570" is mentioned in the original text, so what operation does "in APC step 570" correspond to specifically, whether one or more critical dimensions are measured, or the exposure of the next wafer is calculated for the number n0 wafers For measurement, it is necessary to check the flow chart in the accompanying drawings for confirmation. It can be clearly seen in the figure above that step 570 is a mathematical expression, interpreted as calculating the exposure dose of wafer n+1 based on wafer n, and there is an n>n0 judgment step before step 570, when the conditional relationship n The result of >n0 is negative, that is, step 570 is performed only when n≤n0, which also means that step 570 is performed for all wafers n≤n0. Therefore, the original translation "in APC step 570, up to a predefined number n0 of wafers" is incorrect.

【例句】Up to a predefined number n0 of wafers, the APC settings can be calculated in APC step 570 based on one or more previously measured CD(n), CD(n-1) for the next single The exposure dose of the wafer.

【例17】The safety net 5 is arranged to be supported by and connected to a frame structure 6 which extends at a height above the support structure 2.

【原文】The safety net 5 is arranged to be supported by and connected to a frame structure 6 extending at a certain height above the support structure 2 .

[Analysis] The grammatical structure of the original text is relatively clear. The safety net 5 is supported by and connected to the frame structure 6, and the frame structure 6 extends above the support structure 2. However, "extends at a height" can mean "extending at a certain height" or "extending to a certain height", which needs to be confirmed by referring to the corresponding drawings. It can be clearly seen in the above and below figures that the frame structure 6 is directly connected to the supporting structure 2 as the foundation, and the frame structure 6 extends upwards from the supporting structure 2 and extends to a certain height above it, instead of In the original translation, "extending at a certain height above the supporting structure 2", the latter will be interpreted as a distance of a certain height between the frame structure 6 and the supporting structure 2.

The structure of the safety net in Fig.

【例句】The safety net 5 is arranged to be supported by and connected to a frame structure 6 extending to a certain height above the support structure 2 .

(2) Nested use of a large number of similar terms and their translation processing

In electromechanical patents, in order to clearly define the structural features of a product and the relationship between features, it is necessary to use a large number of similar terms at the same level to name features and feature relationships, examples are as follows:

1) Equipment category, such as facility, plant, equipment, instrument, apparatus, device, assembly, etc.

2) Component classes, such as component, part, means, member, element, piece, etc.

3) Connection, such as connect, couple, attach, affix, bond, link, join, etc.

4) Holes/holes, such as hole, aperture, opening, port, orifice, bore, mouth.

5) Gaps, such as gap, void, cavity, pore, clearance, etc.

6) Depression, such as slot, slit, groove, recess, depression, dimple, pit, etc.

7) Protrusion, such as land, island, bump, raise, protrusion, projection, boss, embossment, etc.

8) Rod/column, such as rod, bar, post, stud, pole, pillar, column, lever, stick.

9) Group/set, such as a set, a group, a cluster, a bundle.

10） 设置/限定，如be arranged to，configured to，defined to，adapted to，designed to，sized to，shaped to。

Some of these homogeneous terms are used interchangeably in a broad sense, while some have nuances in strictly technical meanings. Based on the principle of being faithful to the original text, all technical features are required to be translated differently. However, when multiple (such as more than 5) similar terms appear in an article at the same time, the translator often feels short of words. To solve this difficulty, the translator needs to obtain an accurate technical understanding based on the accompanying drawings, judge the scope and subtle differences between the features referred to by each term, and at the same time have considerable accumulation in the vocabulary of the target language.

Take "equipment/device" as an example. In the field of machinery, English apparatus is often greater than device, and Chinese corresponds to "equipment" greater than "device". In the field of communication, English is more often than device than apparatus, and Chinese is still "device". "is greater than "device", which shows that in the field of machinery and communication, the customary choices for apparatus and device are opposite.

(3) The related use of different forms of word stems and their translation processing

In electromechanical patents, words describing device components and their functions often have obvious correlations, because electromechanical patents generally use functional descriptions when describing product components, such as: processor, for processing...; imaging device, Used for imaging of…; shifting device, used for shifting…; data acquisition device, used for obtaining data of…… This also makes the relationship between nouns and verbs in electromechanical patents, which needs to be considered in translation question.

【Example 18】Translation of different forms of word stems in electromechanical patents.

An arm is pivotally attached to the base. (pivotally)

The pivot3230 is attached to a support unit3260.（枢轴）

Said lever 3 is pivoted on pin7，supported by base element8.（枢接）

At least the application unit is arranged such that it can be pivoted relative to the surface about a pivoting axis.（枢转）

The silent chain is formed of a plurality of link plates that are pivotably interconnected to each other via connecting pins.（可枢转地）

(4) Deliberation and use of terms in different contexts

When emphasizing terminology consistency to translators, translators sometimes neglect proper technical understanding by focusing too much on consistency. The premise of following term consistency is that the same term does refer to the same technical feature, and in patent documents, especially in electromechanical patent documents, it is common for the same term to have different meanings in different contexts The phenomenon.

【例19】Braking intensity indicator system including selective adjustment of brake pedal light and related methods.

【原句】A brake light intensity indicator system and related method including selectively adjusting a brake pedal light.

【Analysis】Generally, before translating electromechanical patents, it is best to read the background technology first, so as to have a general understanding of the technical problems to be solved by the present invention, so as to confirm the specific scope of application of key terms. In the background section it is described as follows: Some break lights are activated only when the break pedal is depressed and generally do not give any indication of how quickly or how far the brake pedal is being depressed. is activated when the brake pedal is depressed, and usually does not give any indication of how fast or how far the brake pedal is depressed.) To increase driver awareness, some braking systems provide an indication of intensity of braking. (For To improve driver perception, some braking systems provide an indication of the intensity of the brake light.) An aspect is directed to a method of selectively adjusting an intensity of at least one brake light of a vehicle. (One aspect involves a A method for selectively adjusting the intensity of at least one brake light of a vehicle.)

It can be understood from these descriptions that braking intensity refers to the strength and distance of depressing the brake pedal, that is, the braking intensity. This intensity is displayed by the brake light in the present invention, so the intensity can be translated in the context of the indicator light. It is light intensity, but it is obviously not the light intensity when combined with braking.

【例20】The present invention relates to a method for determining the distance to the outer surface of a roll of material, and more particularly, for determining the quantity of material remaining on a dispensing or take-up roller.

【原文】The present invention relates to a method for determining the distance to the outer surface of a roll of material, and more particularly for determining the amount of material remaining on a distribution or take-up roll.

[Analysis] When translating mechanical and electrical patents, after simply converting each term in the source language into the target language, it is often necessary to read the translation thoroughly. For example, if the translation is from English to Chinese, if the meaning of the translation cannot be understood, there may be a problem with the translation. In this sentence, both roll and roller are translated as "roller". From the original text, determine the "distance from the outer surface of the roll" to judge the amount of remaining material on the "roller". Obviously, roll and roller are not the same object. Then look for more support from the context. The instructions describe "The facility includes a roll mandrel 12 rotatably mounted on a machine frame 14 that sup-

ports a roll of material 16 that is rotatably driven to take-up(wind) or dispense(unwind) the roll of material 16.” From “take-up or dispense the roll”, it is clear that the roll is not a roll, but a roll of material .

【例句】The present invention relates to a method for determining the distance to the outer surface of a roll of material, and more particularly for determining the amount of material remaining on a distribution or take-up roll.

100% help for your patent affairs with professional translation support

100 Fen Information Technology Co., Ltd. (100 Fen), as a professional patent translation company, understands the importance of translation in the global patent application and protection process. 100% has cooperated with many global industry leaders, many global intellectual property offices and many patent firms for many years, providing them with high-quality, accurate and fast translation services to ensure that customers' patent affairs are well supported .

100 Fen Translation Company has a strict translation and quality control process, as well as a professional team with knowledge of intellectual property rights, technical knowledge in related fields, and language pairing capabilities, to ensure the provision of high-quality patent document translation services. Our patent translation major covers a wide range of fields, including machinery/engineering, electronics/communication, medicine/chemical industry, high-end equipment manufacturing, new energy, new materials, etc. 100% is not only familiar with terminology and language styles in various technical fields, but also understands the requirements and regulations of patent application and protection in various countries.

One hundred percent service commitment:

Accurate and professional translations to ensure the quality and integrity of patent application and protection documents

Quick response and delivery to ensure that the work can be completed within the time limit based on customer needs

Flexible customization of translation service solutions

The services we provide for patent affairs include but are not limited to: translation of patent application documents, translation of patent examination documents, translation of patent litigation documents. Specialized in languages ​​including Simplified Chinese-English translation, Traditional Chinese-English translation, Chinese-Japanese translation, Chinese-Korean translation, Chinese-German translation, etc.

Our goal is to be your reliable translation partner and provide you with the best support in your patent matters. If you have any translation needs or questions, please feel free to contact us, we will serve you wholeheartedly.

100 Fen Translation Company has a strict translation and quality control process, as well as a professional team with intellectual property knowledge, technical knowledge in related fields, and language pairing capabilities, to ensure the provision of high-quality patent document translation services.